segunda-feira, 1 de novembro de 2021

ENEM_CN_2021_1ªAp

ENEM 2021 - 1ª APLICAÇÃO
ENEM 2021 - CIÊNCIAS DA NATUREZA - 1ª APLICAÇÃO

01
(ENEM 2021 - 1ª Aplicação).

Um garoto precisa montar um circuito que acenda três lâmpadas de cores diferentes, uma de cada vez. Ele dispõe das lâmpadas, de fios, uma bateria e dois interruptores, como ilustrado, junto com seu símbolo de três pontos. Quando esse interruptor fecha AB, abre BC e vice-versa.


O garoto fez cinco circuitos elétricos usando os dois interruptores, mas apenas um satisfaz a sua necessidade. Esse circuito é representado por

A
B
C
D
E

Para que uma única lâmpada se acenda de cada vez, o circuito que satisfaz a condição é o da alternativa “D”.

• Somente a lâmpada verde acende.

• Somente a lâmpada vermelha acende.

• Somente a lâmpada azul acende.

Portanto, alternativa "D".

(Créditos da resolução: Prof. Warles)


02
(ENEM 2021 - 1ª Aplicação).

Na cidade de São Paulo, as ilhas de calor são responsáveis pela alteração da direção do fluxo da brisa marítima que deveria atingir a região de mananciais. Mas, ao cruzar a ilha de calor, a brisa marítima agora encontra um fluxo de ar vertical, que transfere para ela energia térmica absorvida das superfícies quentes da cidade, deslocando-a para altas altitudes. Dessa maneira, há condensação e chuvas fortes no centro da cidade, em vez de na região de mananciais. A imagem apresenta os três subsistemas que trocam energia nesse fenômeno.

No processo de fortes chuvas no centro da cidade de São Paulo, há dois mecanismos dominantes de transferência de calor: entre o Sol e a ilha de calor, e entre a ilha de calor e a brisa marítima.

VIVEIROS, M. Ilhas de calor afastam chuvas de represas. Disponível em www2.feis.unesp.br. Acesso em:3 dez. 2019 (adaptado).

Esses mecanismos são, respectivamente,

A
B
C
D
E

O mecanismo dominante de transferência de calor entre o Sol e a ilha de calor é a irradiação e, entre a ilha de calor e a brisa marítima, é a convecção das massas de ar.

Portanto, alternativa "A".

(Créditos da resolução: Curso Objetivo)


03
(ENEM 2021 - 1ª Aplicação).

No seu estudo sobre a queda dos corpos, Aristóteles afirmava que se abandonarmos corpos leves e pesados de uma mesma altura, o mais pesado chegaria mais rápido ao solo. Essa ideia está apoiada em algo que é difícil de refutar, a observação direta da realidade baseada no senso comum.

Após, uma aula de física, dois colegas estavam discutindo sobre a queda dos corpos, e um tentava convencer o outro de que tinha razão:

Colega A: “O corpo mais pesado cai mais rápido que um menos pesado, quando largado de uma mesma altura. Eu provo, largando uma pedra e uma rolha. A pedra chega antes. Pronto! Tá provado!”.

Colega B: “Eu não acho! Peguei uma folha de papel esticado e deixei cair. Quando amassei, ela caiu mais rápido. Como isso é possível? Se era a mesma folha de papel, deveria cair do mesmo jeito. Tem que ter outra explicação!”.

HÜLSENDEGER, M. Uma análise das concepções dos alunos sobre a queda dos corpos. Caderno Brasileiro de Ensino de Física, n. 3, dez. 2004 (adaptado).

O aspecto físico comum que explica a diferença de comportamento dos corpos em queda nessa discussão é o(a)

A
B
C
D
E

No movimento de queda, é sabido que a aceleração da gravidade é a mesma para todos os corpos.

No experimento do segundo aluno a mesma folha cai em tempos diferentes, pois, ao amassá-la, o colega B altera a área de contato entre o papel e o ar.

Assim, altera a força de resistência do ar sobre a folha de papel.

Portanto, alternativa "B".

(Créditos da resolução: Curso Objetivo)


04
(ENEM 2021 - 1ª Aplicação).

A obtenção de etanol utilizando a cana-de-açúcar envolve a fermentação dos monossacarídeos formadores da sacarose contida no melaço. Um desses formadores é a glicose ([tex]C_{6}H_{12}O_{6}[tex]), cuja fermentação produz cerca de 50 g de etanol a partir de 100 g de glicose, conforme a equação química descrita.

[tex] C_{6}H_{12}O_{6}  \overrightarrow{Fermentação\ alcoólica}  2\ C_{3}CH_{2}OH + 2\ CO_{2}[tex]

Em uma condição específica de fermentação, obtém-se 80% de conversão em etanol que, após sua purificação, apresenta densidade igual a 0,80 g/mL. O melaço utilizado apresentou 50 kg de monossacarídeos na forma de glicose.

O volume de etanol, em litro, obtido nesse processo é mais próximo de

A
B
C
D
E

Cálculo da quantidade de etanol produzido, considerando rendimento de 80% = 0,8 e 50kg = 50 000 g.

    [tex] 100\ g\ de\ glicose\ ....\ 50\ g\ de\ etanol [tex]

    [tex] 50\ 000\ g \cdot 0,8\ ....\ x [tex]

    [tex]100x = 50\ 000 \cdot 50 \cdot 0,8 [tex]

    [tex]100x = 2\ 000\ 000 [tex]

    [tex]x = \frac{2\ 000\ 000}{100} [tex]

    [tex]x = 20\ 000\ gramas\ de\ etanol [tex]

Agora, o cálculo do volume de etanol, considerando a densidade (0,80 g/mL):

    [tex] d = \frac{m}{V} [tex]

    [tex] 0,8 = \frac{20\ 000}{V} [tex]

    [tex] V = \frac{20\ 000}{0,8} [tex]

    [tex] V = 25\ 000\ mL = 25\ litros [tex]

Portanto, alternativa "C".

(Créditos da resolução: Curso Objetivo)


05
(ENEM 2021 - 1ª Aplicação).

No cultivo por hidroponia, são utilizadas soluções nutritivas contendo macronutrientes e micronutrientes essenciais. Além dos nutrientes, o pH é um parâmetro de extrema importância, uma vez que ele afeta a preparação da solução nutritiva e a absorção dos nutrientes pelas plantas. Para o cultivo de alface, valores de pH entre 5,5 e 6,5 são ideais para o seu desenvolvimento.

As correções de pH são feitas pela adição de compostos ácidos ou básicos, mas não devem introduzir elementos nocivos às plantas. Na tabela, são apresentados alguns dados da composição da solução nutritiva de referência para esse cultivo. Também é apresentada a composição de uma solução preparada por um produtor de cultivo hidropônico.

LENZI, E.; FAVERO, L. O. B.; LUCHESE, E. B. Introdução à química da água: ciência, vida e sobrevivência. Rio de Janeiro: LTC, 2012 (adaptado)

Para correção do pH da solução nutritiva preparada, esse produtor pode empregar uma solução de

A
B
C
D
E

Para correção do pH da solução nutritiva preparada, deve-se empregar uma solução que provoque aumento do pH, sem introduzir elementos químicos nocivos às plantas. Entre as soluções apresentadas nas alternativas, a solução de hidróxido de potássio pode ser utilizada, pois haverá neutralização dos íons [tex]H^{+}[tex] (por conta dos íons [tex]OH^{-}[tex] do [tex]KOH[tex]) presentes no solo, provocando aumento do pH e da concentração de íons [tex]K^{+}[tex] que não são nocivos.

Portanto, alternativa "E".

(Créditos da resolução: Curso Objetivo)


06
(ENEM 2021 - 1ª Aplicação).

O sino dos ventos é composto por várias barras metálicas de mesmo material e espessura, mas de comprimentos diferentes, conforme a figura.

Considere [tex]f_{1}[tex] e [tex]v_{1}[tex], respectivamente, como a frequência fundamental e a velocidade de propagação do som emitido pela barra de menor comprimento, e [tex]f_{2}[tex] e [tex]v_{2}[tex] são essas mesmas grandezas para o som emitido pela barra de maior comprimento.

As relações entre as frequências fundamentais e entre as velocidades de propagação são, respectivamente,

A
B
C
D
E

No sino dos ventos, a barra de menor comprimento produz o som fundamental mais agudo, isto é, uma maior frequência, ocorrendo o oposto com a barra de maior comprimento, logo:

    [tex]f_{1} > f_{2}[tex]

Independentemente da frequência, todos os sons se propagam no ar, de um mesmo ambiente, com a mesma intensidade de velocidade, algo entorno de 340 m/s.

    [tex]v_{1} = v_{2}[tex]

Portanto, alternativa "D".

(Créditos da resolução: Curso Objetivo)


07
(ENEM 2021 - 1ª Aplicação).

O polvo mimético apresenta padrões cromáticos e comportamentos muito curiosos. Frequentemente, muda a orientação de seus tentáculos, assemelhando-se a alguns animais. As imagens 1, 3, e 5 apresentam polvos mimetizando, respectivamente, um peixe-linguado (2), um peixe-leão (4) e uma serpente-marinha (6).

NORMAN, M. D.; FINN, J.; TREGENZA, T. Dynamic mimicry in an Indo-Malayan octopus. In: Proceedings of the Royal Society B: Biological Sciences, n. 268, out. 2021. Disponível em: www.researchgate.net. Acesso em: 15 mar. 2014 (adaptado).

Do ponto de vista evolutivo, a capacidade apresentada se estabeleceu porque os polvos

A
B
C
D
E

A capacidade mimética apresentada pelo polvo foi uma importante característica do indivíduo, a qual conferiu uma vantagem evolutiva em relação aos demais polvos ancestrais, possibilitando sua sobrevivência em fase das pressões seletivas do ambiente.

Portanto, alternativa "E".

(Créditos da resolução: Curso Objetivo)


08
(ENEM 2021 - 1ª Aplicação).

Uma escola iniciou o processo educativo para implantação da coleta seletiva e destino de materiais recicláveis. Para atingir seus objetivos, a instituição planejou:

1) Sensibilizar a comunidade escolar, desenvolvendo atividades em sala e extraclasse de maneira contínua;

2) capacitar o pessoal responsável pela limpeza da escola quanto aos novos procedimentos adotados com a coleta seletiva; e

3) distribuir coletores de materiais recicláveis específicos nas salas, pátio e outros ambientes para acondicionamento dos resíduos.

Para completar a ação proposta no ambiente escolar, o que falta ser inserido no planejamento?

A
B
C
D
E

Conforme o enunciado, o projeto desenvolvido visava a coleta seletiva mas também a destinação de produtos recicláveis. Tal objetivo não foi contemplado nas atividades propostas na escola, sendo assim alcançado através de parcerias com prefeituras e cooperativas de reciclagem.

Portanto, alternativa "B".

(Créditos da resolução: Curso Objetivo)


09
(ENEM 2021 - 1ª Aplicação).

Os búfalos são animais considerados rústicos pelos criadores e, por isso, são deixados no campo sem controle reprodutivo. Por causa desse tipo de criação, a consanguinidade é favorecida, proporcionando o aparecimento de enfermidades, como o albinismo, defeitos cardíacos, entre outros. Separar os animais de forma adequada minimizaria a ocorrência desses problemas.

DAME,M. C. F. RIET-CORREA, F: SCHILF, A. L; Pesq. Vet. Bras., n. 7. 2013 (adaptado).

Qual procedimento biotecnológico prévio é recomendado nessa situação?

A
B
C
D
E

O mapeamento genético dos búfalos permitiria a escolha de reprodutores com maior variabilidade genética, o que diminuiria a expressão de doenças hereditárias decorrentes do cruzamento entre parentes (endocruzamento).

Portanto, alternativa "E".

(Créditos da resolução: Curso Objetivo)


10
(ENEM 2021 - 1ª Aplicação).

O ciclo do cobre é um experimento didático em que o cobre metálico é utilizado como reagente de partida. Após uma sequência de reações (I, II, III, IV e V), o cobre retorna ao seu estado inicial ao final do ciclo.

A reação de redução do cobre ocorre na etapa

A
B
C
D
E

Etapa I: Cobre sofre oxidação.

Etapas II, III e IV: Não ocorre oxidação e redução do cobre (não ocorre variação do número de oxidação do cobre).

Etapa V: Cobre sofre redução.

Portanto, alternativa "E".

(Créditos da resolução: Curso Objetivo)


11
(ENEM 2021 - 1ª Aplicação).

Um dos exames clínicos mais tradicionais para medir a capacidade reflexa dos indivíduos é o exame do reflexo patelar. Esse exame consiste na estimulação da patela, um pequeno osso localizado na parte anterior da articulação do joelho, com um pequeno martelo. A resposta reflexa ao estímulo é caracterizada pelo levantamento da perna em que o estímulo foi aplicado.

Qual região específica do sistema nervoso coordena essa resposta?

A
B
C
D
E

O reflexo patelar é gerado através de um arco reflexo simples, ou seja, não envolve a participação do encéfalo. Seu centro coordenador ocorre na medula espinhal ou raquidiana.

Portanto, alternativa "B".

(Créditos da resolução: Curso Objetivo)


12
(ENEM 2021 - 1ª Aplicação).

Na montagem de uma cozinha para um restaurante, a escolha do material correto para as panelas é importante, pois a panela que conduz mais calor é capaz de cozinhar os alimentos mais rapidamente e, com isso, há economia de gás. A taxa de condução do calor depende da condutividade [tex]k[tex] do material da sua área A, da diferença de temperatura [tex]∆T[tex] e da espessura d do material, sendo dada pela relação [tex]\frac{∆Q}{∆t} = k A \frac{∆t}{d}[tex].

Em panelas com dois materiais, a taxa de condução é dada por [tex]\frac{∆Q}{∆t} = A \frac{∆t}{\frac{d_{1}}{k_{1}} + \frac{d_{2}}{k_{2}}}[tex], em que [tex]d_{1}[tex] e [tex]d_{2}[tex] são as espessuras dos dois materiais, e [tex]k_{1}[tex] e [tex]k_{2}[tex] são as condutividades de cada material. Os materiais mais comuns no mercado para panelas são o alumínio ([tex]k =\ 20\ W/m K[tex]), o ferro ([tex]k =\ 8\ W/m K[tex]) e ao aço ([tex]k =\ 5\ W/m K[tex]) combinado com o cobre ([tex]k =\ 40\ W/m K[tex]).

Compara-se uma panela de ferro, uma de alumínio e uma composta de [tex]\frac{1}{2}[tex] da espessura em cobre e [tex]\frac{1}{2}[tex] da espessura em aço, todas com a mesma espessura total e com a mesma área de fundo.

A ordem crescente da mais econômica para a menos econômica é

A
B
C
D
E

A ordem crescente de economia de energia consiste em ordenar a opção com maior taxa de condução de calor. Calculando os três casos:

Caso 1: Panela de Ferro.

    [tex]ϕ_{(ferro)} = \frac{∆Q}{∆t} = k A \frac{∆t}{d} [tex]

    [tex]ϕ_{(ferro)} = \frac{∆Q}{∆t} = 8 \cdot A \frac{∆t}{d} [tex]

Caso 2: Panela de Alumínio.

    [tex]ϕ_{(alumínio)} = \frac{∆Q}{∆t} = k A \frac{∆t}{d} [tex]

    [tex]ϕ_{(alumínio)} = \frac{∆Q}{∆t} = 20 \cdot A \frac{∆t}{d} [tex]

Caso 3: Panela metade Cobre e metade Aço.

    [tex] ϕ_{(cobre-aço)} = \frac{∆Q}{∆t} = A \frac{∆t}{\frac{d_{1}}{k_{1}} + \frac{d_{2}}{k_{2}}}[tex]

    [tex] ϕ_{(cobre-aço)} = \frac{∆Q}{∆t} =\frac{A\ \cdot ∆t}{\frac{0,5d}{40} + \frac{0,5d}{5}}[tex]

    [tex] ϕ_{(cobre-aço)} = \frac{∆Q}{∆t} =\frac{A\ \cdot ∆t}{\frac{0,5d}{40} + \frac{4d}{40}}[tex]

    [tex] ϕ_{(cobre-aço)} = \frac{∆Q}{∆t} = \frac{A\ \cdot ∆t}{\frac{4,5d}{40}} [tex]

    [tex] ϕ_{(cobre-aço)} = \frac{∆Q}{∆t} = A\ \cdot ∆t \cdot\ \frac{40}{4,5d} [tex]

    [tex] ϕ_{(cobre-aço)} = \frac{∆Q}{∆t} = A\ \cdot ∆t \cdot\ \frac{8,9}{d} [tex]

    [tex] ϕ_{(cobre-aço)} = \frac{∆Q}{∆t} = 8,9\ \cdot \frac{A\ \cdot ∆t}{d} [tex]

Dessa forma, comparando os resultados obtidos, tem-se:

  [tex]ϕ_{(alumínio)} > ϕ_{(cobre-aço)} > ϕ_{(ferro)} [tex]

Logo, a ordem crescente da mais econômica para a menos econômica é:

    [tex]alumínio,\ cobre-aço\ e\ ferro [tex]

Portanto, alternativa "B".

(Créditos da resolução: Curso Objetivo)


13
(ENEM 2021 - 1ª Aplicação).

A figura foi extraída de um antigo jogo de computadores, chamado Bang! Bang!


No jogo, dois competidores controlam os canhões A e B , disparando balas alternadamente com o objetivo de atingir o canhão do adversário; para isso, atribuem valores estimados para o módulo de velocidade inicial de disparo [tex](|\overrightarrow{v_{0}}|)[tex] e para o ângulo de disparo [tex](θ)[tex].

Em determinado momento de uma partida, o competidor B deve disparar; ele sabe que a bala disparada anteriormente, [tex]θ = 53º[tex], passou tangenciando o Ponto P.

No jogo, [tex]|\overrightarrow{g}|[tex] é igual a [tex]10\ m/s^{2}[tex]. Considere [tex]sen\ 53° = 0,8[tex], [tex]cos\ 53° = 0,6[tex] e desprezível a ação de dissipativas.

Disponível em: http://mebdownloads.butzke.net.br . Acesso em: 18 abr. 2015 (adaptado).

Com base nas distâncias dadas e mantendo o último ângulo de disparo, qual deveria ser, aproximadamente, o menor valor de [tex]|\overrightarrow{v_{0}}|[tex] que permitiria ao disparo pelo canhão B atingir o canhão A?

A
B
C
D
E

Observe a representação na figura a seguir:


Na direção horizontal, temos:

    [tex]ΔS_{x} = Vo_{x} \cdot t[tex]

    [tex]120 = Vo \cdot cos\ 53° \cdot t[tex]

    [tex]120 = 0,6 \cdot Vo\ t[tex]

    [tex]\frac{120}{0,6} = Vo\ t[tex]

    [tex]Vo\ t = 200   (I)[tex]

Na direção vertical, temos:

    [tex]ΔS_{y} = Vo_{y}\ t + \frac{g_{y}}{2}\ t^{2} [tex]

    [tex]35 = (Vo \cdot sen\ 53º) t + \frac{(-\ 10)}{2}\ t^{2} [tex]

    [tex]35 = Vo \cdot 0,8t -\ 5\ t^{2}   (II)[tex]

Substituindo (I) em (II), obtemos:

    [tex]35 = Vo\ t \cdot 0,8 -\ 5\ t^{2} [tex]

    [tex]35 = 200 \cdot 0,8 -\ 5\ t^{2} [tex]

    [tex]5\ t^{2} = 160\ -\ 35 [tex]

    [tex]5\ t^{2} = 125 [tex]

    [tex]t^{2} = \frac{125}{5} [tex]

    [tex]t^{2} = 25 [tex]

    [tex]t = \sqrt{25} [tex]

    [tex]t = 5\ s [tex]

Por último, na expressão (I), temos:

    [tex]Vo\ t = 200 [tex]

    [tex]Vo \cdot 5 = 200 [tex]

    [tex]Vo = \frac{200}{5} [tex]

    [tex]Vo = 40\ m/s [tex]

Portanto, alternativa "C".

(Créditos da resolução: Curso Objetivo)


14
(ENEM 2021 - 1ª Aplicação).

Os pesticidas organoclorados foram amplamente empregados na agricultura, contudo, em razão das suas elevadas toxicidades e persistências no meio ambiente, eles foram banidos. Considere a aplicação de 500 g de um pesticida organoclorado em uma cultura e que, em certas condições, o tempo de meia-vida do pesticida no solo seja de 5 anos.

A massa do pesticida no decorrer de 35 anos será mais próxima de

A
B
C
D
E

A massa inicial do pesticida é de 500 g. Com o passar de um tempo de meia vida, a massa caia à metade. Como o tempo de meia vida é de 5 anos e o tempo que o problema quer que se passe é de 35 anos.

Sendo assim, precisamos dividir 35 por 5 para saber quantos tempos de meia vida vão passar.

    [tex] \frac{35}{5} = 7 [tex]

Sendo assim, temos:

[tex]500 g\  \overrightarrow{\color{blue}{5\ anos}} 250g\  \overrightarrow{\color{blue}{5\ anos}} 125g\  \overrightarrow{\color{blue}{5\ anos}}  \\ 62,5g  \overrightarrow{\color{blue}{5\ anos}} 31,25\  \overrightarrow{\color{blue}{5\ anos}} 15,625g\  \overrightarrow{\color{blue}{5\ anos}}  7,8125g  \overrightarrow{\color{blue}{5\ anos}} 3,906g [tex]

Sendo assim, a massa após 35 anos é de aproximadamente 3,9 g.

Portanto, alternativa "A".

(Créditos da resolução: Curso Objetivo)


15
(ENEM 2021 - 1ª Aplicação).

A sequência de nucleotídeos do RNA mensageiro presentes em um gene de um fungo, constituída de sete códons, está escrita a seguir.

1 234567
AUGUUUGUUCAAUGUAGUUAG

Pesquisadores submeteram a sequência a mutações independentes. Sabe-se que os códons UAG e UAA são terminais, ou seja, indicam a interrupção da tradução.

Qual mutação produzirá a menor proteína?

A
B
C
D
E

A substituição da base nitrogenada citosina pela uracila no códon 4 produz o códon terminal UAA, que interrompe a leitura de códons.

Essa mutação produz um sequência de apenas 3 aminoácidos, em comparação com as demais, que produzem sequências com um número maior de aminoácidos.

Portanto, alternativa "B".

(Créditos da resolução: Curso Objetivo)


16
(ENEM 2021 - 1ª Aplicação).

A simples atitude de não jogar direto no lixo ou no ralo da pia o óleo de cozinha usado pode contribuir para a redução da poluição ambiental. Mas o que fazer com o óleo vegetal que não será mais usado? Não existe um modelo ideal de descarte, mas uma alternativa simples tem sido reaproveitá-lo para fazer sabão. Para isso, são necessários, além do próprio óleo, água e soda cáustica.

LOBO, I. Sabão feito com óleo de cozinha. Disponível em: http://pga.pgr.mpf.gov.br. Acesso em: 29 fev. 2012 (adaptado).

Com base no texto, a reação química que permite o reaproveitamento do óleo vegetal é denominada

A
B
C
D
E

A reação de síntese do sabão a partir do óleo de cozinha é uma reação de saponificação. Onde nós temos uma reação de éster com base forte produzindo sal orgânico e álcool.


No caso do óleo, temos um triéster (triglicerídeo) reagindo com uma base forte e produzindo o sabão que é um sal orgânico e o glicerol que é um triálcool.

Portanto, alternativa "E".

(Créditos da resolução: Curso Objetivo)


Durante o desenvolvimento embrionário humano ocorre uma comunicação entre os átrios direito e esquerdo através do forame oval (ou forame de Botal). Essa comunicação não causa prejuízos à circulação do bebê em formação, exceto se ela perdurar após o nascimento.

Os prejuízos no período embrionário são evitados porque a circulação fetal se assemelha à dos (as)

A
B
C
D
E

Os pulmões do feto, cheios de líquido, aumentam a resistência ao fluxo sanguíneo, fazendo com que o sangue flua do átrio direito para o esquerdo (pelo forame oval), sendo direcionado para a circulação sistêmica, ao invés de seguir para os pulmões. Assim, a circulação se assemelha a uma circulação simples, tal como ocorre em peixes, pois o sangue passa pelo coração apenas uma vez por ciclo.

Portanto, alternativa "D".

(Créditos da resolução: Curso Objetivo)


18
(ENEM 2021 - 1ª Aplicação).

TEXTO I

No cordel intitulado Senhor dos Anéis, de autoria de Gonçalo Ferreira da Silva, lê-se a sextilha:

    A distância em relação

    Ao nosso planeta amado

    Pouco menos que a do Sol

    Ele está distanciado

    E menos denso que a água

    Quando no normal estado

MEDEIROS, A.; AGRA, J. T. M., A astronomia na literatura de cordel, Física na Escola, n. 1, abr. 2010 (fragmento)

TEXTO II

Distâncias médias dos planetas ao Sol e suas densidades médias

Planetas Distância média
ao Sol (u.a.)
Densidade
relativa média
*Mercúrio0,395,6
*Vênus0,725,2
*Terra1,05,5
*Marte1,54,0
**Ceres2,82,1
*Júpiter5,21,3
*Saturno9,60,7
*Urano191,2
*Netuno301,7
**Plutão402,0
**Éris682,5

Características dos planetas. Disponível em: www.astronoo.com. Acesso em: 8 de nov. 2019 (adaptado)

Considerando os versos de sextilha e as informações da tabela, a qual planeta o cordel faz referência?

A
B
C
D
E

A frase “menos denso que a água” nos remete ao planeta Saturno, que é o único cuja densidade relativa à água é menor do que 1.

O nosso Planeta amado, sendo a Terra, está a uma distância de Saturno de 8,6 ua, que é pouco menor que a distância de Saturno ao Sol (9,6 ua).

Portanto, alternativa "D".

(Créditos da resolução: Curso Objetivo)


19
(ENEM 2021 - 1ª Aplicação).

Cientistas da Universidade de New South Wales, na Austrália, demonstraram em 2012 que a Lei de Ohm é válida mesmo para fios finíssimos, cuja área da seção reta compreende alguns poucos átomos. A tabela apresenta as áreas e comprimentos de alguns dos fios construídos (respectivamente com as mesmas unidades de medida). Considere que a resistividade mantém-se constante para todas as geometrias (uma aproximação confirmada pelo estudo).

ÁreaComprimentoResistência
elétrica
Fio 19312 R1
Fio 2447 R2
Fio 3254 R3
Fio 41106 R4

WEBER, S. B. et al. Ohm1s Law Survivers to the atomice sacle. Science, n. 335, jan. 2012 (adaptado)

As resistências elétricas dos fios, em ordem crescente, são

A
B
C
D
E

Com os dados fornecidos na tabela e utilizando-se a fórmula da 2ª lei de Ohm ([tex]R = ρ \cdot \frac{L}{A} [tex]), sendo L o comprimento do fio, R a resistência elétrica e A, a área da secção do fio, temos:

• Para o fio 1:

    [tex]R1 = ρ \cdot \frac{L}{A} = ρ \cdot \frac{312}{9} \cong\ 34,7\ ρΩ [tex]

• Para o fio 2:

    [tex]R2 = ρ \cdot \frac{L}{A} = ρ \cdot \frac{47}{4} = 11,75\ ρΩ [tex]

• Para o fio 3:

    [tex]R3 = ρ \cdot \frac{L}{A} = ρ \cdot \frac{54}{2} = 27\ ρΩ [tex]

• Para o fio 4:

    [tex]R4 = ρ \cdot \frac{L}{A} = ρ \cdot \frac{106}{1} = 106\ ρΩ [tex]

Observando-se os valores encontrados, temos:

    [tex]R2 < R3 < R1 < R4 [tex]

Portanto, alternativa "C".

(Créditos da resolução: Curso Objetivo)


20
(ENEM 2021 - 1ª Aplicação).

Organismos autótrofos e heterótrofos realizam processos complementares que associam os ciclos do carbono e do oxigênio. O carbono fixado pela energia luminosa ou a partir de compostos inorgânicos é eventualmente degradado pelos organismos, resultando em fontes de carbono como metano ou gás carbônico. Ainda, outros compostos orgânicos são catabolizados pelos seres, com menor rendimento energético, produzindo compostos secundários (subprodutos) que podem funcionar como combustíveis ambientais.

O processo metabólico associado à expressão combustíveis ambientais é a

A
B
C
D
E

Os processos de obtenção energética com menor rendimento são realizados sem a utilização do oxigênio, sendo denominados fermentação ou respiração celular anaeróbia.

Portanto, alternativa "B".

(Créditos da resolução: Curso Objetivo)


21
(ENEM 2021 - 1ª Aplicação).

O emprego de células de combustível a hidrogênio pode ser uma tecnologia adequada ao transporte automotivo. O quadro apresenta características de cinco tecnologias mais proeminentes de células de combustível.


Testes operacionais com esses tipos de células têm indicado que as melhores alternativas para veículos são as que operam em baixos níveis de energia térmica, são formadas por membranas de eletrólitos poliméricos e ocorrem em meio ácido.

THOMAS, S; ZALBOWITZ, M. Full cells: green power. Losalamos National Laboratory. Los Alamos, NM, 1999 (adaptado).

A tecnologia testada mais adequada para o emprego em veículos automotivos é a célula de combustível

A
B
C
D
E

Nas células de combustível de hidrogênio, ocorre a seguinte reação:

[tex]H_{2} + \frac{1}{2} O_{2}   \Longrightarrow   H_{2}O [tex]

Na célula AFC a reação se dá em meio básico ([tex]OH^{–}[tex]) na presença de hidróxido de potássio aquoso.

Na célula MSFC a reação ocorre na presença de carbonatos com produção e posterior consumo de [tex]CO_{2}[tex].

Nas células PEM, PAFC, SOFC, a reação se dá em meio ácido ([tex]H^{+}[tex]).

A que opera em baixa temperatura (60°C – 100°C) e na presença de membrana de eletrólito polimérico (ácido poliperfluorssulfônico) é a PEM.

Portanto, alternativa "C".

(Créditos da resolução: Curso Objetivo)


22
(ENEM 2021 - 1ª Aplicação).

Considere a tirinha, na situação em que a temperatura do ambiente é inferior à temperatura corporal dos personagens.


O incômodo mencionado pelo personagem da tirinha deve-se ao fato de que, em dias úmidos,

A
B
C
D
E

O incômodo mencionado pelo personagem da tirinha deve-se ao fato de que, em dias úmidos, o suor tem maior dificuldade para evaporar do corpo e retirar calor da pele para refrescá-la.

Portanto, alternativa "B".

(Créditos da resolução: Curso Objetivo)


23
(ENEM 2021 - 1ª Aplicação).

Entre 2014 e 2016, as regiões central e oeste da África sofreram um grave epidemia de febre hemorrágica causada pelo vírus ebola, que se manifesta em até 21 dias após a infecção e cuja taxa de letalidade (enfermos que vão a óbito) pode chegar a 90%. Em regiões de clima tropical e subtropical, um outro vírus também pode causar febre hemorrágica: o vírus da dengue, que, embora tenha período de incubação menor (até 10 dias), apresenta taxa de letalidade abaixo de 1%.

Disponível em: www.who.int. Acesso em: 1 fev. 2017 (adaptado).

Segundo as informações do texto e aplicando princípios de evolução biológica às relações do tipo patógeno-hospedeiro, qual dos dois vírus infecta seres humanos há mais tempo?

A
B
C
D
E

Com menor taxa de letalidade, o vírus da dengue mostra-se mais eficiente em se dissemina ao longo do tempo.

Portanto, alternativa "E".

(Créditos da resolução: Curso Objetivo)


24
(ENEM 2021 - 1ª Aplicação).

A imagem apresenta as etapas do funcionamento de uma estação individual para tratamento do esgoto residencial.

Como funciona a estação individual


TAVARES, K. Estações de tratamento de esgoto individuais permitem a reutilização da água. Disponível em: https://extra.globo.com. Acesso em: 18 nov 2014 (adaptado).

Em qual etapa decanta-se o lodo a ser separado do esgoto residencial?

A
B
C
D
E

O tratamento de esgoto até o seu devido descarte passa por diferentes etapas. Dentre essas etapas, nós temos o tanque séptico. Neste tanque o resíduo deve permanecer em repouso para que haja uma decantação. Com essa decantação, é possível separar o lodo do esgoto residencial.

Portanto, alternativa "C".

(Créditos da resolução: Curso Objetivo)


25
(ENEM 2021 - 1ª Aplicação).

O plantio por estaquia é um método de propagação de plantas no qual partes de um espécime são colocadas no solo para produzir novas gerações. Na floricultura, é comum utilizar o caule das roseiras para estaquia, pois a propagação da planta é positiva em razão da aplicação de auxinas na porção inferior do caule.

A utilização de auxinas no método de estaquia das roseiras contribui para

A
B
C
D
E

As auxinas são fitormônios de extrema importância no desenvolvimento dos vegetais. São utilizadas para estimular a formação de raízes adventícias quando aplicadas em estacas.

Portanto, alternativa "D".

(Créditos da resolução: Curso Objetivo)


26
(ENEM 2021 - 1ª Aplicação).

A deficiência de lipase ácida lisossômica é uma doença hereditária associada a um gene do cromossomo 10. Os pais dos pacientes podem não saber que são portadores dos genes da doença até o nascimento do primeiro filho afetado. Quando ambos os progenitores são portadores, existe uma chance, em quatro, de que seu bebê possa nascer com essa doença.

ANDERSON, R. A. et. al. In: Situ Localization of the Genetic Locus Encoding the Lysosomal Acid Lipase/Cholesteryl Esterase (LIPA) Deficient in Wolman Disease to Chromosome 10q23.2-q23.3. Genomics, n. 1, jan, 1993 (adaptado).

Essa é uma doença hereditária de caráter

A
B
C
D
E

A doença em questão é causada por um gene recessivo, pois os pais, sendo portadores, mas não afetados, serão heterozigotos e um descente que manifeste a doença será homozigoto recessivo.

Portanto, alternativa "A".

(Créditos da resolução: Curso Objetivo)


27
(ENEM 2021 - 1ª Aplicação).

O quadro lista alguns dispositivos eletrônicos que estão presentes no dia a dia, bem como a faixa de força eletromotriz necessária ao seu funcionamento.

Dispositivo eletrônico Faixa de força
eletromotriz (V)
IRelógio de parede1,2 a 1,5
IICelular3,5 a 3,8
IIICâmare digital7,5 a 7,8
IVCarrinho de
controle remoto
10,5 a 10,9
VNotebook/Laptop19,5 a 20,0

Considere que uma bateria é construída pela associação em série de três pilhas de lítio-iodo, nas condições-padrão, conforme as semiequações de redução apresentadas.

[tex] I_{2} + 2e^{-}   \Longrightarrow   2\ I^{-}   E^{o} = +\ 0,54\ V[tex]

[tex] Li^{+} + e^{-}   \Longrightarrow   Li   E^{o} = -\ 3,05\ V[tex]

Essa bateria é adequada para o funcionamento de qual dispositivo eletrônico?

A
B
C
D
E

Temos como dado do problema duas semirreações de redução.

[tex] I_{2} + 2e^{-}   \Longrightarrow   2\ I^{-}   E^{o} = +\ 0,54\ V[tex]

[tex] Li^{+} + e^{-}   \Longrightarrow   Li   E^{o} = -\ 3,05\ V[tex]

Sendo assim, a ddp para essa pilha pode ser calculada por:

    [tex]ddp = E^{o}_{(red.\ maior)}\ -\ E^{o}_{(red.\ menor)} [tex]

    [tex]ddp = + 0,54\ -\ (-\ 3,05) [tex]

    [tex]ddp = + 3,59 [tex]

Como nós temos uma bateria formada por três pilhas em série, a ddp gerada será:

    [tex] 3 × 3,59\ V = 10,77\ V [tex]

Portanto ela será adequada para o carrinho de controle remoto que está na faixa de 10,5 até 10,9.

Portanto, alternativa "D".

(Créditos da resolução: Curso Objetivo)


28
(ENEM 2021 - 1ª Aplicação).

O alcoolômetro Gay Lussac é um instrumento destinado a medir o teor de álcool, em porcentagem de volume (v/v), de soluções de água e álcool na faixa de 0º GL a 100ºGL, com divisões de 0,1ºGL. A concepção do alcoolômetro se baseia no princípio de flutuabilidade de Arquimedes, semelhante ao funcionamento de um densímetro.

A escala do instrumento é aferida a 20ºC, sendo necessária a correção da medida, caso a temperatura da solução não esteja na temperatura de aferição. É apresentada parte da tabela de correção de um alcoolômetro, com a temperatura.

Tabela de correção do alcoolômetro
com temperatura 20°C
ºGLLeitura da temperatura (°C)
202122232425
3535,034,634,233,833,433,0
3636,035,635,234,834,434,0

Manual alcoolômetro Gay Lussac. Disponível em: www.incoterm.com.br. Acesso em: 4 dez. 2018 (adaptado).

É necessário a correção da medida do instrumento, pois um aumento na temperatura promove o(a)

A
B
C
D
E

Essa correção é necessária porque à medida que a temperatura aumenta, o volume do material aumenta por dilatação, fazendo com que a concentração de volume diminua com esse aumento. Na tabela é possível que a porcentagem está diminuindo à medida que a temperatura aumenta.

Portanto, alternativa "C".

(Créditos da resolução: Curso Objetivo)


29
(ENEM 2021 - 1ª Aplicação).

O Prêmio Nobel de Química de 2000 deveu-se à descoberta e ao desenvolvimento de polímeros condutores. Esses materiais têm ampla aplicação em novos dispositivos eletroluminescentes (LEDs), células fotovoltaicas etc. Uma propriedade-chave de um polímero condutor é a presença de ligações duplas conjugadas ao longo da cadeia principal do polímero.

ROCHA FILHO, R. C. Polímeros condutores: descoberta e aplicações. Química Nova na Escola. n. 12, 2000 (adaptado).

Um exemplo desse polímero é representado pela estrutura


A
B
C
D
E

O polímero que possui duplas conjugadas (ligações duplas separadas por ligação simples) é o composto com a fórmula abaixo:


Utilizando duas unidades, podemos observar as duplas conjugadas:


Portanto, alternativa "D".

(Créditos da resolução: Curso Objetivo)


30
(ENEM 2021 - 1ª Aplicação).

Com o objetivo de identificar a melhor espécie produtora de madeira para construção (com resistência mecânica e à degradação), foram analisadas as estruturas anatômicas de cinco espécies, conforme o quadro.


Qual espécie corresponde ao objetivo proposto?

A
B
C
D
E

A melhor espécie produtora de madeira para construção, com maior resistência mecânica e à degradação, é aquela que apresenta maior quantidade de células mortas lignificadas, o que é encontrado em abundância nas porções de tecido xilemático mais antigo, denominado “cerne”.

Segundo a tabela, a espécie “1” é a que apresenta maior quantidade de tecido.

Portanto, alternativa "A".

(Créditos da resolução: Curso Objetivo)


31
(ENEM 2021 - 1ª Aplicação).

No outono, as folhas de árvores mudam de cor, de verde para tons de amarelo, castanho, laranja e vermelho. A cor de verde das folhas deve-se ao pigmento clorofila. Nas plantas de folhas caducas, a produção de clorofila diminui e o tom verde desvanece, permitindo assim que outros pigmentos, como o caroteno, de coloração amarelo-alaranjado, e a antocianina, de tons avermelhados, passem a dominar a tonalidade das folhas. A coloração observada se dá em função da interação desses pigmentos com a radiação solar.

Conforme apresentado no espectro de absorção, as moléculas de clorofila absorvem a radiação solar nas regiões do azul e do vermelho, assim a luz refletida pelas folhas tem falta desses dois tons e as vemos na cor verde. Já as antocianinas absorvem a luz desde o azul até o verde. Nesse caso, a luz refletida pelas folhas que contêm antocianinas aparece conforme as cores complementares, ou seja, vermelho-alaranjado.


Disponível em: https://vidauniversoydemas.wordpress.com. Acesso em: 6 dez. 2017 (adaptado)

Em qual faixa do espectro visível os carotenos absorvem majoritariamente?

A
B
C
D
E

Os carotenos apresentam coloração amarelo/alaranjado e por isso refletem os comprimentos de onda entre 560 e 630 nm. Assim, sua maior absorção de luz para a fotossíntese dar-se-á nos comprimentos de onda entre 400 a 480 nm, que representam as cores violeta e azul.


Portanto, alternativa "A".

(Créditos da resolução: Curso Objetivo)


32
(ENEM 2021 - 1ª Aplicação).

As águas subterrâneas têm sido contaminadas pelo uso de pesticidas na agricultura. Entre as várias substâncias usualmente encontradas, algumas são apresentadas na figura. A distinção dessas substâncias pode ser feita por meio de uma análise química qualitativa, ou seja, determinando sua presença mediante a adição de um reagente específico.


O hidróxido de sódio é capaz de identificar a presença de um desses pesticidas pela reação ácido-base de Brönsted-Lowry.

O teste positivo será observado com o pesticida

A
B
C
D
E

Identifica-se o pesticida usando NaOH por meio da reação ácido-base de Bronsted-Lowry.

Logo, o pesticida deve apresentar caráter ácido.

O Pesticida III apresenta a função fenol, com caráter ácido.


Portanto, alternativa "C".

(Créditos da resolução: Curso Objetivo)


33
(ENEM 2021 - 1ª Aplicação).

Com o aumento da população de suínos no Brasil, torna-se necessária a adoção de métodos para reduzir o potencial poluidor dos resíduos dessa agroindústria, uma vez que, comparativamente ao esgoto doméstico, os dejetos suínos são 200 vezes mais poluentes. Sendo assim, a utilização desses resíduos como matéria-prima na obtenção de combustíveis é uma alternativa que permite diversificar a matriz energética nacional, ao mesmo tempo em que parte dos recursos hídricos do país são preservados.

BECK, A. M. Resíduos suínos como alternativa energética sustentável. XXVII Encontro Nacional de Engenharia de Produção. Anais ENEGEP, Foz do Iguaçu, 2007 (adaptado).

O biocombustível a que se refere o texto é o

A
B
C
D
E

    Biogás é um tipo de biocombustível produzido a partir de materiais orgânicos de origem vegetal e animal que são decompostos produzindo uma mistura de gases na qual predomina o metano ([tex]CH_{4}[tex]).

  [tex]Matéria\ orgânica\ →\ CH_{4} + CO_{2}\ +\ resíduo[tex]

Portanto, alternativa "B".

(Créditos da resolução: Curso Objetivo)


34
(ENEM 2021 - 1ª Aplicação).

A curcumina, uma das substâncias que confere a cor alaranjada ao açafrão, pode auxiliar no combate à dengue quando adicionada à água de criadouros do mosquito transmissor. Essa substância acumula-se no intestino do inseto após ser ingerida com a água do criadouro e, quando ativada pela luz, induz a produção de espécies reativas de oxigênio que danificam de forma fatal o tecido do tubo digestório.

TOLEDO, K. Corante do açafrão pode ser útil no combate à dengue. Disponível em: http://agencia.fapesp.br. Acesso em: 25 abr. 2015. (adaptado).

A forma de combate relatada tem como atividade o(a)

A
B
C
D
E

A destruição do tecido do tubo digestório da larva do vetor da dengue ocasiona a sua morte, diminuindo o risco da transmissão da virose.

Portanto, alternativa "D".

(Créditos da resolução: Curso Objetivo)


35
(ENEM 2021 - 1ª Aplicação).

A icterícia, popularmente conhecida por amarelão, é uma patologia frequente em recém-nascidos. Um bebê com icterícia não consegue metabolizar e excretar de forma eficiente a bilirrubina. Com isso, o acúmulo dessa substância deixa-o com a pele amarelada. A fototerapia é um tratamento de icterícia neonatal, que consiste na irradiação de luz no bebê. Na presença de luz, a bilirrubina é convertida no seu isômero lumirrubina que, por ser mais solúvel em água, é excretada pela bile ou pela urina. A imagem ilustra o que ocorre nesse tratamento.

MOREIRA, M. et. al. O recém-nascido de alto risco: teoria e prática do cuidar [on-line]. Rio de Janeiro: Fiocruz, 2004 (adaptado).


WANG, J. et. al. Challenges of phototherapy for neonatal hyperbilirubinemia (Review). Experimental and Therapeutic Medicine, n. 21, 2021 (adaptado).

Na fototerapia, a luz provoca a conversão de bilirrubina no seu isômero

A
B
C
D
E

A transformação da bilirrubina em lumirrubina (também chamada de ciclobilirrubina) é um caso de isomeria de cadeia.


Observe que do lado esquerdo da fórmula ocorre fechamento da cadeia carbônica.

Portanto, alternativa "C".

(Créditos da resolução: Curso Objetivo)


36
(ENEM 2021 - 1ª Aplicação).

Analisando a ficha técnica de um automóvel popular, verificam-se algumas características em relação ao seu desempenho. Considerando o mesmo automóvel em duas versões, uma delas funcionando a álcool e outra, a gasolina, tem-se os dados apresentados no quadro, em relação ao desempenho de cada motor.

Parâmetro Motor a
gasolina
Motor a
álcool
Aceleraçãode 0 a 100km/h
em 13,4s
de 0 a 100km/h
em 12,9s
Velocidade
máxima
165 km/h163 km/h

Considerando desprezível a resistência do ar, qual versão apresenta a maior potência?

A
B
C
D
E

O conceito de Potência nos remete à taxa de transferência de energia cinética, isto é, a razão entre a energia cinética e o tempo gasto para obtê-la.

De O a 100 km/h a variação de energia cinética é a mesma, porém, o tempo gasto pela versão à álcool é menor (12,9 s) e, portanto, o carro à álcool desenvolve maior potência.

Portanto, alternativa "C".

(Créditos da resolução: Curso Objetivo)


37
(ENEM 2021 - 1ª Aplicação).

Estudo aponta que a extinção de preguiças-gigantes, cuja base da dieta eram frutos e sementes, provocou impactos consideráveis na vegetação do Pantanal brasileiro. A flora, embora não tenha desaparecido, tornou-se menos abundante que no passado, além de ocupar áreas mais restritas.

BICUDO, F. Jardineiro da pesada. Ecologia. Pesquisa Fapesp, ed. 231, maio 2015 (adaptado).

O evento descrito com a flora ocorreu em razão da redução

A
B
C
D
E

A extinção das preguiças-gigantes influenciou na redução da área e da abundância da flora devido ao fato desses animais utilizarem frutas e sementes na sua dieta e, com o desaparecimento deles, a dispersão dos vegetais diminuiu.

Portanto, alternativa "C".

(Créditos da resolução: Curso Objetivo)


38
(ENEM 2021 - 1ª Aplicação).

Carros elétricos estão cada vez mais baratos, no entanto, os órgãos governamentais e a indústria se preocupam com o tempo de recarga das baterias, que é muito mais lento quando comparado ao tempo gasto para encher o tanque de combustível. Portanto, os usuários de transporte individual precisam se conscientizar dos ganhos ambientais dessa mudança e planejar com antecedência seus percursos, pensando em pausas necessárias para recargas.

Após realizar um percurso de 110 km, um motorista pretende recarregar as baterias de seu carro elétrico, que tem um desempenho médio de 5,0 km/kWh, usando um carregador ideal que opera a uma tensão de 220 V e é percorrido por uma corrente de 20 A.

Quantas horas são necessárias para recarregar a energia utilizadas nesse percurso?

A
B
C
D
E

Cálculo da energia elétrica consumida no percurso sabendo que o consumo médio é de 5 km/kWh e com deslocamento de 110 km.

    [tex] E = \frac{110\ km}{5\ km/kWh} = 22\ kWh [tex]

O carregador ideal opera com uma potência dada por:

    [tex] P = i \cdot U [tex]

    [tex] P = 20 \cdot 220 [tex]

    [tex] P = 4\ 400\ W = 4,4\ kW [tex]

Agora, podemos determinar o tempo necessário para recarga da bateria.

    [tex] E = P \cdot Δt [tex]

    [tex] 22 = 4,4 \cdot Δt [tex]

    [tex] \frac{22}{4,4} = Δt [tex]

    [tex] Δt = 5h [tex]

Portanto, alternativa "D".

(Créditos da resolução: Curso Objetivo)


39
(ENEM 2021 - 1ª Aplicação).

Nas angiospermas, além da fertilização da oosfera, existe uma segunda fertilização que resulta num tecido triploide.

Essa segunda fertilização foi importante evolutivamente, pois viabilizou a formação de um tecido de

A
B
C
D
E

O endosperma triplóide acumula reservas que, juntamente com os cotilédones, garantem o início do desenvolvimento do embrião no processo de germinação da semente.

Portanto, alternativa "B".

(Créditos da resolução: Curso Objetivo)


40
(ENEM 2021 - 1ª Aplicação).

Com o objetivo de proporcionar aroma e sabor a diversos alimentos, a indústria alimentícia se utiliza de flavorizantes. Em geral, essas substâncias são ésteres, como as apresentadas no quadro.


O aroma do flavorizante derivado do ácido etanoico e que apresenta cadeia carbônica saturada é de

A
B
C
D
E

O aroma do flavorizante derivado do ácido etanóico (acético), de fórmula:


e que apresenta cadeia carbônica saturada (ligação simples entre átomos de carbono) é o acetato de isoamila.

aroma de banana

Portanto, alternativa "B".

(Créditos da resolução: Curso Objetivo)


41
(ENEM 2021 - 1ª Aplicação).

O eletrocardiograma é um exame cardíaco que mede a intensidade dos sinais elétricos advindo do coração. A imagem apresenta o resultado típico obtido em um paciente saudável e a intensidade do sinal (VEC) em função do tempo.


De acordo com o eletrocardiograma apresentado, qual foi o número de batimentos cardíacos por minuto desse paciente durante o exame?

A
B
C
D
E

A figura (eletrocardiograma), obtém-se o período T dos batimentos cardíacos do paciente.

    [tex]T = 5 \cdot 0,2\ s [tex]

    [tex]T = 1,0\ s [tex]

A frequência [tex]f[tex] é o inverso do período. Logo:

    [tex]f = \frac{1,0}{T} = \frac{1,0}{1,0} = 1,0\ Hz [tex]

Então, o número (N) de batimentos cardíacos do paciente em 1 minuto (60s):

    [tex]f = \frac{N}{Δt} [tex]

    [tex]1 = \frac{N}{60} [tex]

    [tex]N = 60\ batimentos\ cardíacos [tex]

Portanto, alternativa "B".

(Créditos da resolução: Curso Objetivo)


42
(ENEM 2021 - 1ª Aplicação).

Um técnico analisou um lote de analgésicos que supostamente estava fora das especificações. A composição prevista era 100mg de ácido acetilsalicílico por comprimido (princípio ativo, cuja estrutura está apresentada na figura), além do amido e da celulosa (componentes inertes). O técnico realizou os seguintes testes:

1) obtenção da massa do comprimido;

2) medição da densidade do comprimido;

3) verificação do pH com papel indicador;

4) determinação da temperatura de fusão do comprimido;

5) titulação com solução aquosa de NaOH.

Após a realização dos testes, o lote do medicamento foi reprovado porque a quantidade de ácido acetilsalicílico por comprimido foi de apenas 40% da esperada.


Ácido acetilsalicílico

O teste permitiu reprovar o lote de analgésicos foi o de número

A
B
C
D
E

O teste 5 permitiu reprovar o lote de analgésicos, uma vez que o ácido acetilsalicílico possui caráter ácido e, quando é realizada a titulação do ácido com solução aquosa de NaOH, é determinada sua quantidade no lote, mostrando que era 40% da esperada.


Portanto, alternativa "E".

(Créditos da resolução: Curso Objetivo)


43
(ENEM 2021 - 1ª Aplicação).

O rompimento da barragem de rejeitos de mineração no município mineiro de Mariana e o derramamento de produtos tóxicos nas águas do Rio Doce, ocorridos em 2015, ainda têm consequências para os organismos que habitam o Parque Nacional Marinho de Abrolhos, localizado a mais de 1 000 quilômetros de distância. Esse desastre ambiental afetou o fitoplâncton, as esponjas, as algas macroscópicas, os peixes herbívoros e os golfinhos.

FRAINER, G.; SICILIANO, S.; TAVARES, D. C. Fransciscana calls for help: […]. International Whaling Commission, Conference Paper, jun. 2016 (adaptado)

Concentrações mais elevadas dos compostos citados são encontradas em

A
B
C
D
E

Os produtos tóxicos liberados acumulam-se ao longo da cadeia alimentar e afetam de forma mais pronunciada os seres com nível trófico elevado. Entre os seres citados, o que apresenta maior nível trófico é o golfinho.

Portanto, alternativa "B".

(Créditos da resolução: Curso Objetivo)


44
(ENEM 2021 - 1ª Aplicação).

Duas esferas carregadas com cargas iguais em módulo e sinais contrários estão ligadas por uma haste rígida isolante na forma de haltere. O sistema se movimenta sob ação da gravidade numa região que tem um campo magnético horizontal uniforme [tex](\overrightarrow{B})[tex], da esquerda para a direita. A imagem apresenta o sistema visto de cima para baixo, no mesmo sentido da aceleração da gravidade [tex](\overrightarrow{g})[tex] que atua na região.


Visto de cima, o diagrama esquemático das forças magnéticas que atuam no sistema, no momento inicial em que as cargas penetram na região de campo magnético, está representado em

A
B
C
D
E

Observe a figura a seguir:


A velocidade [tex](\overrightarrow{v})[tex] das esferas tem mesma orientação da aceleração da gravidade [tex](\overrightarrow{g})[tex], ou seja, [tex](\overrightarrow{v})[tex] está orientada do leitor para dentro do plano do papel.

Pela “regra da mão esquerda”, determinamos a direção e o sentido da força magnética [tex](\overrightarrow{F})[tex] na carga positiva.


Para a carga negativa, a força magnética tem sentido oposto ao de [tex](\overrightarrow{F})[tex]:


O binário de forças magnéticas no haltere fica:


Portanto, alternativa "A".

(Créditos da resolução: Curso Objetivo)


45
(ENEM 2021 - 1ª Aplicação).

É possível ligar aparelhos elétricos de baixa corrente utilizando materiais comuns de laboratório no lugar das tradicionais pilhas. A ilustração apresenta uma montagem que faz funcionar um cronômetro digital.


Utilizando a representação de projetos elétricos, o circuito equivalente a esse sistema é

A
B
C
D
E

O sistema apresentado é formado por duas pilhas de cobre/zinco em que o cobre forma o polo positivo e o zinco o polo negativo.

O cronômetro pode ser considerado um elemento resistivo de circuito.

O medidor de tensão elétrica é um voltímetro cuja representação no circuito é:

Todos os elementos estão ligados em paralelo aos terminais extremos das duas pilhas que, por sua vez, estão ligadas em série.

Assim, o circuito equivalente a esse sistema pode ser representado por:

Portanto, alternativa "B".

(Créditos da resolução: Curso Objetivo)




Nenhum comentário:

Postar um comentário